Partial time line
1928 -- Griffith and bacterial transformation
1944 -- Avery, MacLeod and McCarty --- DNA as the transforming principle
1949 -- Chargaff and base composition of DNA
1952 -- Hershey and Chase on DNA of virus entering bacterial cells
1952 -- Franklin and x-ray diffraction pattern of DNA
1953 -- Watson-Crick paper 25 April 1953, along with two DNA papers on X-ray diffraction
1955 -- Benzer and gene fine structure
1957 -- Crick and "central dogma"
1958 -- Meselson and Stahl on semi-conservative replication of DNA
1959 -- Kornberg isolation of DNA polymerase
1961 -- Nirenberg and Matthaei - a sequence of nucleotides can encode an amino acid
1962 -- Nobel prize for Watson, Crick and Wilkins
Bacterial transformation
Initial work of Frederick Griffith
Streptooccus pneumoniae, two strains, smooth virulent and rough nonvirulent
In 1928 described the change from R to S
S and R strains into mice...Fig 8.2
heat killed S + living R strain into mice results in transformation of R to S
Then, work in laboratory of Oswald Avery, with Colin MacLeod, and Maclyn McCarty
Avery picture.... Avery.GIF (not on web)
Work described in: McCarty, M. (1985). The Transforming Principle. New York, W. W. Norton
"The pivotal discovery of 20th-century biology" ... J. Lederberg on their work with transformation
The transforming principle identified as DNA Fig. 8.3
Franklin (not on web)... Franklin.gif
review of new book: Blow, D. 2002 Encounters with a dark lady. Nature 418: 725-726. and photo.. Franklin.gif
Famous Photograph 51 (not on web) .... ../../Other%20Graphics/FranklinFigure51.gif
X-ray diffraction.(Figure 9.9b).. 9x9b.gif
Maddox, B. (2002). Rosalind Franklin : the dark lady of DNA. New York, HarperCollins.
Some early questions
two or three strands?
bases on inside or outside?
coiling paranemic or plectonemic; if plectonemic how about replication?
Watson and Crick(not on web)--- WatsonandCrick.gif
DNA polymer made up of repeating units, the nucleotides
composed of sugar, nitrogenous base, and phosphate
for structures see Figures 8.5, 8.6, 8.7 (not to be memorized for this course)
elementary structure ... nucleotide.GIF
Complimentary base pairing (see Figure 8.11)... 9x11.gif
Models (see Figure 8.10 in text).. 9x10.gif
short double helix
nucleotideModel.gif
properties of the model (most discussed later)
double helix with anti parallel strands
semiconservative replication
carry genetic information
From the anniversary issue of Nature:
"It has become customary, both in textbooks and in the regular scientific literature, to explain molecular mechanisms through simple two-dimensional drawings or 'cartoons' . Such drawings are useful for consolidating large amounts of data into a simple scheme, as illustrated in this review. But a whole generation of biologists may have become lulled into believing that the essence of a biological mechanism has been captured, and the entire problem therefore solved, once a researcher has deciphered enough of the puzzle to be able to draw a meaningful cartoon of this type." ..... Alberts, B. (2003). DNA replication and recombination. Nature 421(6921): 431-5.
On the c-value paradox on page 173.
Table 8.3 C-values of selected species
Also see: C-value.gif and CvalueNuclei.gif
On kinds of chromosome material:
euchromatin
heterochromatin
facultative and constitutive
Heterochromatin.GIF
packaging of DNA into chromosome
Base composition of each human chromosome .. basecomp.html
The observation on compaction of DNA into chromosomes
Electron microscope pictures see Figure 8.19, 8.20 ... 16x4 Griffith.gif
The interpretation
nucleosome composed of core of 4 proteins x 2 = 8; DNA coiled twice around nucleosome
Histone proteins of the core: H2A, H2B, H3, H4
Additional histone, H1, for higher order organization
See pictures in text:
series (not on web, see text) ... ../ChromosomeStructure.html
nucleosome core ... Fig 8.17. ...../../Other%20Graphics/8-17.gif
nucleosome structure ... Fig 8.18 ... ../../Other%20Graphics/8-18.gif
30 nm fiber ......Fig 8.20b .. .../../Other%20Graphics/8-20b.gif
30 nm fiber on scaffold ... Fig 8.21 ../../Other%20Graphics/8-21.gif
orders of packaging ... Fig 8.22 ......../../Other%20Graphics/8-22.gif
Astounding pictures !!!!
Another observation: EM histone depleted chromosome...
from Paulson and Laemmli; Cell, 12:817 1977
1) composite picture (not on web, will share reprint)
2) attachment to scaffold (not on web, will share reprint)
Model scaffold attachment regions.Fig 8.21... 10x13.gif
Centromeres
From a recent review: "On monocentric chromosomes the centromere is the chromosomal site at which the kinetochore complex is assembled. This complex mediates the attachment and movement of chromosomes along spindle microtubules. The centromere is usually the last site to retain cohesion between sister centromeres"
from: Pidoux, A. L. and R. C. Allshire. 2000 Centromeres: getting a grip of chromosomes. Current Opinion in Genetics & Development 12: 308-319.
Fairly simple in baker's yeast point type, one fiber .... CentromerePoint.gif
Complex in higher eukaryotes, regional type, multiple fibers.. CentromereReg.gif
In the regional type of centromere there is generally a lot of highly repetitive noncoding sequences of DNA. One type is called alphoid DNA, consisting of repteitive sequences about 171 nucleotides long, showing some variation from chromosome to chromosome. One such sequence in humans at about one million copies per chromosome is:
ccttcgttcg aaacgggtat atcttcacat gccatctaga cagaagcatc ctcagaagcttctctgtgat gactgcattc aactcacgga gttgaactct ccttttgaga gcgcagttttgaaactctct ttctgtggca tctgcaaggg gacatgtaga cctctttgaa g
3 November 2004
remember seminar on Friday, 4PM, 107 SB-1;
http://www.stanford.edu/dept/Emed//imo/alan.htmlWe have looked at the structure of DNA, the structure of the eukaryotic chromosome, the special region of the centromere
Let us consider the telomere structure in chapter 9.
And, end this chapter with a consideration of types of DNA.... see hand out, read pages 178 and 179.
Telomeres
Observations of Barbara McClintock; loss of end of chromosome (by radiation, breakage of paracentric inversion anaphase-I bridge) leads to fusion of ends of chromatids
Telomere problem...3'overhanging end (ledge)
Why the ledge..... DNAledge.gif
show end of chromosome T and D loops
Traced from cover of journal Cell volume 97(4) TelomereLoop.gif
and
from: Greider, C. W. 1999 Telomeres do d-loop-t-loop. Cell 97: 419-422..... TelomereLoop4.gif
telomeric repeats
mammals - AGGGTT
Tetrahymena - GGGGTT
Arabidopsis - AGGGTTT
subtelomeric repeats, etc.
two problems with telomere
1. the single strand of DNA at the end of the chromosome. Solution: D loop t loop
2. the inability to complete the replication of the end of the chromosome. Solution: telomerase (discussed later)
Question about reduced telomere length in premature aging syndromes. The answer is yes. See: Allsopp, R. C., et al. 1992 Telomere length predicts replicative capacity of human fibroblasts. Proc Natl Acad Sci U S A 89(21): 10114-8.
Also inherited disorder dyskeratosis congenita. See... Marciniak, R. A., F. B. Johnson, and L. Guarente. 2000 Dyskeratosis congenita, telomeres and human ageing. Trends Genet 16(5): 193-5.
Types of DNA (incomplete list)
Handout - typesofdna2.html
Chromosome organization ... ChromosomeOrganization.gif see handout
Problem of "junk" DNA... JunkGarbage.gif; ref: Nowak, R., Mining treasures from 'junk DNA', in Science. 1994, p. 608-610.